SuzukiSavage.com - Print Page

SuzukiSavage.com
/cgi-bin/YaBB.pl
General Category >> Politics, Religion (Tall Table) >> And everyone is just Baffled..
/cgi-bin/YaBB.pl?num=1675343702

Message started by justin_o_guy2 on 02/02/23 at 05:15:02

Title: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 05:15:02

https://goodsciencing.com/covid/athletes-suffer-cardiac-arrest-die-after-covid-shot/

Keep repeating
Safe and Effective..

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 06:03:51

And the vaccine also causes cancer.
University research has shown that the vaccine does enter the DNA. And there the ability to correct mistakes in multiplication is damaged. Resulting in cancer.

So every time you hit a booster you play roulette.
Here's the link to the news.

https://www.youtube.com/watch?v=4Unt03UBhbU

And if you want I will find you the whole investigation with all the details.

Shortly thereafter, it was denied by big pharma and dismissed as a conspiracy. But the research stands.
And several investigations followed.
Like this one from 2 months ago.

https://www.youtube.com/watch?v=uxoL3Fy93Ro

The covid scam is easy to see if you look a little deeper than what is being said in the media and on various platforms.

The established health care system readily accepts the advice that is handed to it from above.
That's their internal structure.
So it can happen that an information officer is selling the really questionable statement that the vaccine is safe.

While he himself is 100% convinced that it is save.

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 06:21:17

I was Wrong about the jabs. I knew I wouldn't ever take it. I knew it wasn't going to be good. But I'm shocked at just how awful it is and how many are Still Pushing it.
Trump Seriously needs to admit they are bad and stfu about telling people to take them.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 06:36:05

He can not do that. The denial of all the problems surrounding the whole covid thing is too great.
The illusion that has been erected is too strong.
And because we all live in a kind of illusion, we consciously or unconsciously choose the safest side.

It works like this:

Keep your mouth shut. You’re probably being filmed and it’s gonna show up on Twitter and websites across the world. You’ll be looking for a job before the end of the day and for the rest of your life this will follow you around.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 07:07:18

In every tradition based on awakening (enlightenment) it is said that it is not without danger.

Once you rebel. Like jesus Socrates and many many others did (Resently Bagwan) You are in danger.

Of course I'm not saying that Trump is enlightened or anything (it's obvious he isn't) but I just want to point out how dangerous it is when you rebel against the established order.

An enlightened can do nothing about it.
He or she has fallen together with god. They can only be completely spontaneous. the word compromise does not exist for them. never will they deny god.
He or she literally can't help to rebel. There very being is a insult to how we live.

That's also why the taboo on seeking enlightenment is so big. You better be a gay than a seeker of truth.

That is also the reason that, for example, Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.
And in turn, Serowbot also highlights our illutions. Because there are plenty of them.

Don't forget that the entire conspiracy community is also going wrong on many fronts.
There is no other way, because we all live in the illusion that we are someone, with an identity.

And we defend that identity to death. That's how strong the illusion is.

And by truth, of course, I don't mean certain theories, or images or facts.

It's nobody,s fault. Nobody's because this is a collective illusion.
And collective illusions are very, very strong. You have to think for a moment that the whole of humanity thinks all day long.
Maybe you can imagine how strong the force field is.

I think I'm a bit off topic....

Title: Re: And everyone is just Baffled..
Post by Serowbot on 02/02/23 at 07:37:34

2D3221323932393225303E32570 wrote:

Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

Title: Re: And everyone is just Baffled..
Post by splash07 on 02/02/23 at 07:54:29

6F796E736B7E73681C0 wrote:

[quote author=2D3221323932393225303E32570 link=1675343702/0#4 date=1675350438]Serowbot will never turn around until the entire community accepts that covid was made in a lab, has been used for political purposes and is absolutely not safe. And what not.

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 08:07:40

When Experts disregard Natural Immunity, I'm smarter.
If students were Not smarter than teacher,society would never move forward.
The Experts running things are FUKKING UP HORRIBLY.
Yeah, I'm smarter.

You better be a gay than a seeker of truth.

Saying the quiet part out loud..

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 08:56:29

6E786F726A7F72691D0 wrote:

There is position A, and there is position B...
If you can admit ignorance in biological science, the smart move is to believe those with the knowledge you don't have. The other option is to think yourself wiser than experts.
Do you think that's smart?[/quote]

RESPONSE:

First read the research from the Stockholm University.
And then I can tell from your reaction whether you see me, or whether you let your prejudices speak.

first_page
settings
Order Article Reprints
Open AccessArticle
SARS–CoV–2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro
by Hui Jiang
1,2,* and Ya-Fang Mei
2,*
1
Department of Molecular Biosciences, The Wenner–Gren Institute, Stockholm University, SE-10691 Stockholm, Sweden
2
Department of Clinical Microbiology, Virology, Umeå University, SE-90185 Umeå, Sweden
*
Authors to whom correspondence should be addressed.
Viruses 2021, 13(10), 2056; https://doi.org/10.3390/v13102056
Received: 20 August 2021 / Revised: 8 September 2021 / Accepted: 8 October 2021 / Published: 13 October 2021 / Retracted: 10 May 2022
(This article belongs to the Special Issue SARS-CoV-2 Host Cell Interactions)
Download Browse Figures
Versions Notes

Abstract
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) has led to the coronavirus disease 2019 (COVID–19) pandemic, severely affecting public health and the global economy. Adaptive immunity plays a crucial role in fighting against SARS–CoV–2 infection and directly influences the clinical outcomes of patients. Clinical studies have indicated that patients with severe COVID–19 exhibit delayed and weak adaptive immune responses; however, the mechanism by which SARS–CoV–2 impedes adaptive immunity remains unclear. Here, by using an in vitro cell line, we report that the SARS–CoV–2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines.
Keywords:
SARS–CoV–2; spike; DNA damage repair; V(D)J recombination; vaccine

1. Introduction
Severe acute respiratory syndrome coronavirus 2 (SARS–CoV–2) is responsible for the ongoing coronavirus disease 2019 (COVID–19) pandemic that has resulted in more than 2.3 million deaths. SARS–CoV–2 is an enveloped single positive–sense RNA virus that consists of structural and non–structural proteins [1]. After infection, these viral proteins hijack and dysregulate the host cellular machinery to replicate, assemble, and spread progeny viruses [2]. Recent clinical studies have shown that SARS–CoV–2 infection extraordinarily affects lymphocyte number and function [3,4,5,6]. Compared with mild and moderate survivors, patients with severe COVID–19 manifest a significantly lower number of total T cells, helper T cells, and suppressor T cells [3,4]. Additionally, COVID–19 delays IgG and IgM levels after symptom onset [5,6]. Collectively, these clinical observations suggest that SARS–CoV–2 affects the adaptive immune system. However, the mechanism by which SARS–CoV–2 suppresses adaptive immunity remains unclear.
As two critical host surveillance systems, the immune and DNA repair systems are the primary systems that higher organisms rely on for defense against diverse threats and tissue homeostasis. Emerging evidence indicates that these two systems are interdependent, especially during lymphocyte development and maturation [7]. As one of the major double-strand DNA break (DSB) repair pathways, non-homologous end joining (NHEJ) repair plays a critical role in lymphocyte–specific recombination–activating gene endonuclease (RAG) –mediated V(D)J recombination, which results in a highly diverse repertoire of antibodies in B cell and T cell receptors (TCRs) in T cells [8]. For example, loss of function of key DNA repair proteins such as ATM, DNA–PKcs, 53BP1, et al., leads to defects in the NHEJ repair which inhibit the production of functional B and T cells, leading to immunodeficiency [7,9,10,11]. In contrast, viral infection usually induces DNA damage via different mechanisms, such as inducing reactive oxygen species (ROS) production and host cell replication stress [12,13,14]. If DNA damage cannot be properly repaired, it will contribute to the amplification of viral infection-induced pathology. Therefore, we aimed to investigate whether SARS–CoV–2 proteins hijack the DNA damage repair system, thereby affecting adaptive immunity in vitro.
2. Materials and Methods
2.1. Antibodies and Reagents
DAPI (Cat #MBD0015), doxorubicin (Cat #D1515), H2O2 (Cat #H1009), and [ch946]-tubulin antibodies (Cat #T4026) were purchased from Sigma-Aldrich. Antibodies against His tag (Cat #12698), H2A (Cat #12349), H2A.X (Cat #7631), [ch947]–H2A.X (Cat #2577), Ku80 (Cat # 2753), and Rad51(Cat #8875) were purchased from Cell Signaling Technology (Danvers, MA, USA). 53BP1(Cat #NB100-304) and RNF168 (Cat #H00165918–M01) antibodies were obtained from Novus Biologicals (Novus Biologicals, Littleton, CO, USA). Lamin B (Cat #sc–374015), ATM (Cat #sc–135663), DNA–PK (Cat #sc–5282), and BRCA1(Cat #sc–28383) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). XRCC4 (Cat #PA5–82264) antibody was purchased from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Plasmids
pHPRT–DRGFP and pCBASceI were kindly gifted by Maria Jasin (Addgene plasmids #26476 and #26477) [15]. pimEJ5GFP was a gift from Jeremy Stark (Addgene plasmid #44026) [16]. The NSP1, NSP9, NSP13, NSP14, NSP16, spike, and nucleocapsid proteins were first synthesized with codon optimization and then cloned into a mammalian expression vector pUC57 with a C–terminal 6xHis tag. A 12–spacer RSS–GFP inverted complementary sequence–a 23–spacer RSS was synthesized for the V(D)J reporter vector. Then, the sequence was cloned into the pBabe–IRES–mRFP vector to generate the pBabe–12RSS–GFPi–23RSS–IRES–mRFP reporter vector. 12–spacer RSS sequence: 5[ch8242]–CACAGTGCTACAGACTGGAACAAAAACC–3[ch8242]. 23–spacer RSS sequence: 5[ch8242]–CACAGTGGTAGTACTCCACTGTCTGGCTGTACAAAAACC–3[ch8242]. RAG1 and RAG2 expression constructs were generously gifted by Martin Gellert (Addgene plasmid #13328 and #13329) [17].
2.3. Cells and Cell Culture
HEK293T and HEK293 cells obtained from the American Type Culture Collection (ATCC) were cultured under 5% CO2 at 37 °C in Dulbecco’s modified Eagle’s medium (DMEM, high glucose, GlutaMAX) (Life Technologies, Carlsbad, CA, USA) containing 10% (v/v) fetal calf serum (FCS, Gibco), 1% (v/v) penicillin (100 IU/mL), and streptomycin (100[ch8201][ch956]g/mL). HEK293T–DR–GFP and HEK293T–EJ5–GFP reporter cells were generated as previously described and cultured under 5% CO2 at 37 °C in the above-mentioned culture medium.
2.4. HR and NHEJ Reporter Assays
HR and NHEJ repair in HEK293T cells were measured as described previously using DR–GFP and EJ5–GFP stable cells. Briefly, 0.5 × 106 HEK293T stable reporter cells were seeded in 6–well plates and transfected with 2 [ch956]g I–SceI expression plasmid (pCBASceI) together with SARS–CoV–2 proteins expression plasmids. Forty–eight hours post–transfection and aspirin treatment, cells were harvested and analyzed by flow cytometry analysis for GFP expression. The means were obtained from three independent experiments.
2.5. Cellular Fractionation and Immunoblotting
For the cellular fraction assay, the Subcellular Protein Fractionation Kit (Thermo Fisher) was used according to the manufacturer’s instructions. Protein lysates were quantified using the BCA reagent (Thermo Fisher Scientific, Rockford, IL, USA). Proteins were resolved by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE), transferred to nitrocellulose membranes (Amersham protran, 0.45 [ch956]m NC), and immunoblotted with specific primary antibodies followed by HRP–conjugated secondary antibodies. Protein bands were detected using SuperSignal West Pico or Femto Chemiluminescence kit (Thermo Fisher Scientific).
2.6. Comet Assay
Cells were treated with different DNA damage reagents and then harvested at the indicated time points for analysis. Cells (1 × 105 cells/mL in cold phosphate-buffered saline [PBS]) were resuspended in 1% low–melting agarose at 40 °C at a ratio of 1:3 vol/vol and pipetted onto a CometSlide. Slides were then immersed in prechilled lysis buffer (1.2 M NaCl, 100 mM EDTA, 0.1% sodium lauryl sarcosinate, 0.26 M NaOH pH > 13) for overnight (18–20 h) lysis at 4 °C in the dark. Slides were then carefully removed and submerged in rinse buffer (0.03 M NaOH and 2 mM EDTA, pH > 12) at room temperature (RT) for 20 min in the dark. This washing step was repeated twice. The slides were transferred to a horizontal electrophoresis chamber containing rinse buffer and separated for 25 min at a voltage of 0.6 V/cm. Finally, the slides were washed with distilled water, stained with 10 [ch956]g/mL propidium iodide, and analyzed by fluorescence microscopy. Twenty fields with approximately 100 cells in each sample were evaluated and quantified using the Fiji software to determine the tail length (tail moment).
2.7. Immunofluorescence
Cells were seeded on glass coverslips in a 12–well plate and transfected with the indicated plasmid for 24 h. Then, the cells were treated with or without DNA damage reagents according to the experimental setup. The cells were fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT and then permeabilized in 0.5% Triton X–100 for 10 min. Slides were blocked in 5% normal goat serum (NGS) and incubated with primary antibodies diluted in 1% NGS overnight at 4 °C. Samples were then incubated with the indicated secondary antibodies labeled with Alexa Fluor 488 or 555 (Invitrogen) diluted in 1% NGS at RT for 1 h. Thereafter, they were stained with DAPI for 15 min at RT. Coverslips were mounted using Dako Fluorescence Mounting Medium (Agilent) and imaged using a Nikon confocal microscope (Eclipse C1 Plus). All scoring was performed under blinded conditions.
2.8. Analysis of V(D)J Recombination
Briefly, V(D)J reporter plasmid contains inverted-GFP and IRES driving continuously expressed RFP. Continuously expressed RFP is the internal transfection control. After Recombination activation gene1/2 (RAG1/2) co–transfected into the cells, RAG1/2 will cut the RSS and mediated induction of DSBs, if V(D)J recombination occurs, the inverted GFPs are ligated in positive order by NHEJ repair. Then the cell will express functional GFP. So, the GFP and RFP double positive cells are the readout of the V(D)J reporter assay [18]. 293T cells at 70% confluency were transfected with the V(D)J GFP reporter alone (background) or in combination with RAG1 and RAG2 expression constructs, at a ratio of 1 µg V(D)J GFP reporter: 0.5 µg RAG1: 0.5 µg RAG2. The following day, the medium was changed, and after an additional 48 h, cells were harvested and analyzed by flow cytometry for GFP and RFP expression.
2.9. Statistical Analysis
All experiments were repeated at least three times using independently collected or prepared samples. Data were analyzed by Student’s t test or ANOVA followed by Tukey’s multiple-comparison tests using GraphPad 8.
3. Results
3.1. Effect of Nuclear–Localized SARS–CoV–2 Viral Proteins on DNA Damage Repair
DNA damage repair occurs mainly in the nucleus to ensure genome stability. Although SARS–CoV–2 proteins are synthesized in the cytosol [1], some viral proteins are also detectable in the

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 09:14:32

Take it up with the Doctor...

https://bayourenaissanceman.blogspot.com/2023/02/us-military-pilots-may-be-in-world-of.html

Title: Re: And everyone is just Baffled..
Post by WebsterMark on 02/02/23 at 10:09:02

5244534E56434E55210 wrote:

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 10:17:03

First read the research from the Stockholm University.
And then I can tell from your reaction whether you see me, or whether you let your prejudices speak.

There are many things questionable with concluding that this laboratory study is an analogue for what happens to an injected medium. Lets start there.

How are you creating a similar, let alone identical assessment of in vitro high protein saturation to normal/natural protein injections in regards to how BRCA 1 impedes regular bonding?

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 10:20:44

Take it up with the Doctor...

You mean the One doctor that can't seem to read the DCEM correctly? Every other doctor in the military, of which many are anti-mandate is an idiot?

Maybe we can add her to your list of 200+ disabled military staff per-day.

As for the original article, why would you expect a 66 year old who died from cancer to be on the list of "Active Athletes" in Spain? Of course when you start combining 20 year old active athletes to ones that played 45 years prior you will have higher numbers.

58 year old racecar driver "athlete" dies unexpectedly. Yeah lets toss this guy in the young soccer player category. Also some of the people on that DEAD list are still alive, but that never mattered before. And lastly how did they get those percentages without that second number?

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 10:35:47

"The one thing we should all know for sure is that the vaccines were overhyped for political purposes by both sides, but way more on the Democratic side. A lot of people made an awful lot of money off the vaccines, that’s another thing we should all agree to. And we should all agree, that the reputation of our health agencies suffered because they were manipulated for political purposes, both of their own doings in by outside, national political figures."

I would agree with that.

If people would stop grasping for any "proof" they can find that exclusively matches their opinion we could actually discuss some of this. Another thing to understand is that a lot of money is being made on the anti-vaccine side as well. Many of the "truth" exposing websites survive off of the links and modify their content to gain revenue, not tell the truth. Multiple YouTube videos and social media posts were, by the creator's own admissions, made for a monetization grab and contained key words and made-up statistics. Millions of dollars are made this way.

Lies come from all sources, not just the one's we don't want to trust.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 11:11:08

0020222A3720450 wrote:

I don't quite understand your question.

Variants of uncertain significance fundamentally limit the clinical utility of genetic information. The challenge they pose is epitomized by BRCA1, a tumour suppressor gene in which germline loss-of-function variants predispose women to breast and ovarian cancer. Although BRCA1 has been sequenced in millions of women, the risk associated with most newly observed variants cannot be definitively assigned. Here we use saturation genome editing to assay 96.5% of all possible single-nucleotide variants (SNVs) in 13 exons that encode functionally critical domains of BRCA1. Functional effects for nearly 4,000 SNVs are bimodally distributed and almost perfectly concordant with established assessments of pathogenicity. Over 400 non-functional missense SNVs are identified, as well as around 300 SNVs that disrupt expression. We predict that these results will be immediately useful for the clinical interpretation of BRCA1 variants, and that this approach can be extended to overcome the challenge of variants of uncertain significance in additional clinically actionable genes.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 12:00:25

2404060E1304610 wrote:

Reaction:

What do you mean If people would stop grasping for any "proof" they can find that exclusively matches their opinion we could actually discuss some of this..

I knew we were being cheated al along and had to put up whit It. I dont want to discuss it I wanted to show people what happened. I shouted wake up You fools, don't you see....

Im not the one that is deluded You didn't want to look. You were scared and that's not surprising there was a fierce virus. but that was taken advantage of, with something that had not yet gone through the explicit test face. All those lies as transparent as anything..

That arogance... and it's still there.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 12:08:00

I don't quite understand your question.

Yeah I've been through this study many times with many people.

How are you equating a 1-1 DNA impact ratio with the parameters of that study alone? They utilized a higher protien saturation in an in-vitro controlled environment, that if one does follow-up research, multiple laboratories have not been able to reproduce.

It's a good study, but does not reflect normal ratios for injected medication.

What do you mean If people would stop grasping for any "proof" they can find that exclusively matches their opinion we could actually discuss some of this.

There is a difference between looking at information, and going out and only looking at information that tells you what you want to hear.

For instance searching "adolescent cardiac episodes 2018 - 2022", versus searching "Covid vaccine deaths in kids". The second search will only show you what you want to see. The first will provide information you actually have to use your brain and judgement to decipher.

Im not the one that is deluded You didn't want to look. You were scared and that's not surprising there was a fierce virus. but that was taken advantage of, with something that had not yet gone through the explicit test face. All those lies as transparent as anything..

On the contrary I actually flew a team into and out of China when the first cases were exploding in Italy. I expressed my suspicions then, and still to this day have indicated the emergency authorization phase was poorly implemented.

I do not however think millions of kids died from heart attacks, which is consistently claimed each time another one of these articles are posted here. If you use the number provided in the one in this post 243 kids die each day in the US from heart attacks. It's ridiculous to think that's true. If thousands of athletes died in the soccer leagues there would be evidence, like thousands of fewer soccer players.

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 12:30:49

007 lives in amazement of your life.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 12:46:34

Ok, on that bike... Yes, that is not exactly easy in an open discussion.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 12:47:53

"007 lives in amazement of your life."

He probably watches too many movies. Flying to China and back is not very exciting.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 12:54:47

Why don,t you adress "him". I want no part of it.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 13:09:45

"Why don,t you adress "him". I want no part of it."

I did. This is why I used the quotes.

Like now, how I am addressing You by using your quoted words.

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/02/23 at 13:39:57

I don't like it when others talk about me in front of me. unless it's in a 100%positive way. so I don't want to do that myself. That's what I mean.

I think it's nice that we have reached a certain form of openness in this topic. I was also more willing than usual to write things down more thoroughly and explain it how I see it.

Nice to meet you.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 13:52:48

"I think it's nice that we have reached a certain form of openness in this topic. I was also more willing than usual to write things down more thoroughly and explain it how I see it."

Ok, well the study you referenced is good, and deserving of more evaluation, but people are having a hard time replicating it.

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 17:26:50

It's only going to get worse..

few days after receiving her booster injection, the Thai princess “suddenly” collapsed. Three weeks later she remains in a coma. The Thai Royal Family was just informed that the initial “bacterial infection” diagnosis was in fact always untrue; thus, from the very start there was a coordinated coverup by the BigPharma captured authorities.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 17:51:00

I think the data will show worsening outcomes. But I don't need lies and conjecture to get me to think that.

Where are the 2,684 dead soccer players?

Where are the Doctors 2k+ per day disabled soldiers?

Why are these even entertained as conceivable?

Title: Re: And everyone is just Baffled..
Post by justin_o_guy2 on 02/02/23 at 18:22:11

You are so desperate.. Really? The Same thing, again? You are Never correct once you have been wrong. ??
You are being a Jakkass. Move on.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/02/23 at 21:27:06

"You are so desperate.. Really? The Same thing, again? You are Never correct once you have been wrong. ??
You are being a Jakkass. Move on."

The only one desperate here is you for bringing up the same information again, and acting like it's new. The information You posted on this thread shows the numbers I am placing into this thread. If you take the ratios provided and increase deaths by the stated ratios, you get 2,684 dead soccer players since March 2020 - why would you use this information, again?

So they were wrong the first time AND this time when you put the numbers out here again. I read it for you, again, and you want to argue. Do the numbers yourself and show me where I made mistakes, I will gladly go through page by page with you.

Lets start with the base numbers you get from these documents:

https://pubmed.ncbi.nlm.nih.gov/15689345/
https://pubmed.ncbi.nlm.nih.gov/9691102/
https://pubmed.ncbi.nlm.nih.gov/17143117/

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/03/23 at 01:07:33

I want to suggest something else.

Now people with weak health were put into a coma for 2 weeks with the help of a ventilator, with serious death rates and permanent damage as a result.

I suggest you find out for us;

How many human lives could have been saved, if we had been allowed to use the banned regular drugs chloroquine and hydroxychloroquine with the associated treatment method.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/03/23 at 05:17:39

How many human lives could have been saved, if we had been allowed to use the banned regular drugs chloroquine and hydroxychloroquine with the associated treatment method.

How do you propose one find out who would not have died? It would be conjecture at best as every case would have to be evaluated for co-morbidity factors. You assume those drugs are effective, other people want supporting evidence. So far on here the proof has been a Facebook post and a website that admitted they fabricated the patient numbers.

Those drugs aren't banned in the US, I know plenty of people that take it, I know some that died anyway. How are they cures if people still get the disease?

Title: Re: And everyone is just Baffled..
Post by zevenenergie on 02/03/23 at 12:54:11

One way to help people who don't want to budge from their points of view is to invite them to look at other perspectives.
Try to work together by identifying similar goals and highlighting what you agree on.
It is important to communicate in a respectful and open-minded way so that the other person feels heard and understood.
It is also helpful to provide facts and research that support your point of view and emphasize the importance of continuing to learn and grow in our understanding and knowledge of a particular topic.

It is not ethical or right to prevent someone from gathering information or expanding their knowledge. It is important to have respect for others' curiosity and desire for knowledge. If someone is trying to understand or investigate something, it's better to help them find reliable sources of information and support them rather than try to stop them. It's also important to respect a person's ultimate decisions and allow them the freedom to draw their own conclusions.

A discussion can have several disadvantages, including:

Conflict: Discussions can often lead to conflicts and disagreements, which can harm relationships and create tension.

Time-consuming: Discussions can take a lot of time and energy, especially if they are long and intense.

Emotional exhaustion: Engaging in discussions that are heated and emotional can be mentally and emotionally draining.

Limited perspective: In a discussion, people tend to only focus on their own perspectives and ignore other viewpoints, leading to a narrow understanding of the issue.

Ineffective outcome: Despite the time and effort spent on the discussion, it may not result in a productive outcome or solution.

It's important to engage in discussions constructively and with respect for others' opinions to minimize these disadvantages and achieve positive results.

Title: Re: And everyone is just Baffled..
Post by Eegore on 02/03/23 at 13:11:08

One way to help people who don't want to budge from their points of view is to invite them to look at other perspectives.

I prefer to let them keep their point of view. For instance you can think the vaccine causes cancer, I just don't think the study you offered proves it to me. At most it identifies a risk if the drug is administered through protein saturation.

How do you propose one find out who would not have died if they were not on a ventilator?